N or other cyclooxygenase inhibitors were added during platelet preparation. Unless
N or other cyclooxygenase inhibitors were added during platelet preparation. Unless otherwise indicated, 1...
Athways, many not having to do with the atrophy under study.
Athways, many not having to do with the 842-07-9 site atrophy under study.binding of...
Bactin primers (GTGGGGCGCCCCAGGCACCCA, CTCCTT AATGTCACGCACGATTTC) as a housekeeping gene. RNA of
Bactin primers (GTGGGGCGCCCCAGGCACCCA, CTCCTT AATGTCACGCACGATTTC) as a housekeeping gene. RNA of the same sample...
D TTR V30M remained in the supernatant fraction (Fig. 1A
D TTR V30M remained in the supernatant fraction (Fig. 1A). Saturation binding measurements showed...
Specific time points could help direct the choice of therapy and
Specific time points could help direct the choice of therapy and ascertain whether a...
At 37uC in 95 air at 5 carbon dioxide. RAW264.7 stable clones expressing
At 37uC in 95 air at 5 carbon dioxide. RAW264.7 stable clones expressing Teriparatide...
Ace of cellular microtubules such as severing [14] and the binding and
Ace of cellular microtubules such as severing and the binding and motility of...
Ed for, in part, by use of time-dependent surrogates including medical
Ed for, in part, by use of time-dependent surrogates including medical treatment (e.g. statins...
Was less clear, even if single mothers were over represented and
Was less clear, even if single mothers were over represented and married women or...
For accurate quantification. Taxonomy classification based on this combined annotation method
For accurate quantification. Taxonomy classification based on this combined annotation method was in consistency...